Welcome! Click here to login or here to register.
Home
Pathways
Proteins
Catalytic RNA molecules
Enzymatic complexes
Structures
Publications
Draw a picture
 
Search
 
Links
Help
Contact





Bujnicki Lab Homepage

U7 snRNA

Known also as: U7 small nuclear RNA, RNU7-1


NCBI GI number: 187761352 RFAM id: RF00066
Species: Homo sapiens

The U7 small nuclear RNA (U7 snRNP) is an RNA molecule involved in the splicing of metazoan histone pre-mRNAs, which are spliced by a different mechanism than nuclear pre-mRNAs and self-splicing introns. The 5' end of U7 RNA is thought to base-pair to a conserved spacer element downstream of the cleavage site in histone pre-mRNA.


This RNA molecule can be a part of a given complexes: Reactions in which U7 snRNA is involved:
Pathways in which U7 snRNA is involved:

RNA sequence:
CAGUGUUACAGCUCUUUUAGAAUUUGUCUAGUAGGCUUUCUGGCUUUUUA
CCGGAAAGCCCCU


Add your own comment!


There are no comments yet.

Last modification of this entry: Aug. 20, 2012.

Welcome stranger! Click here to login or here to register.