Welcome! Click here to login or here to register.
Home
Pathways
Proteins
Catalytic RNA molecules
Enzymatic complexes
Structures
Publications
Draw a picture
 
Search
 
Links
Help
Contact





Bujnicki Lab Homepage

RPR1

Known also as: RNase P RNA


NCBI GI number: 2570199 RFAM id: RF00009
Species: Saccharomyces cerevisiae

 

FUNCTION:
  1. Component of RNase P complex (which cleaves tRNA precursors to generate mature 5' ends)  (PMID: 11880623, 1990278)
  2. pre-tRNA processing at 5' the end(PMID: 9620854, 1990278)
  3. Box C/D intron-encoded small nucleolar RNAs (snoRNAs) processing (PMID: 18713869)

CELLULAR LOCALIZATION:

Nucleolus (PMID: 11880623)


This RNA molecule can be a part of a given complexes: Reactions in which RPR1 is involved:
Pathways in which RPR1 is involved:

RPR1 (Saccharomyces cerevisiae) belongs to following protein families:
RNA sequence:
GUGGAACAGUGGUAAUUCCUACGAUUAAGAAACCUGUUUACAGAAGGAUC
CCCACCUAUGGGCGGGUUAUCAGAUAUUAUCAGGUGGGAAAUUCGGUGGA
ACACAGUGGAGCCUUGUCCUCCGGGUUAAUGUCGCUUUUGGCAUUGGCCC
CUGCUCCUGAGAGAAGAAAUAUACUGGGGAACCAGUCUUUACCGACCGUU
GUUAUCAGAAAUUCACGGAGUUCGGCCUAGGUCGGACUCCGAUGGGAACG
GCAACGGUUGUUCCGUUUGACUUGUCGCCCGCUACGGCGUGAGCGUCAAG
GUCUGUUGAGUGCAAUCGUAGGACGUCAUUAGUGGCGAACCCGAUACCGA
UUACUGCUGCUGUUCCAGC

References:

Authors Title Journal
Marquez SM, Chen JL, Evans D, Pace NR Structure and function of eukaryotic Ribonuclease P RNA. Mol Cell 2006-11-03
Lee JY, Rohlman CE, Molony LA, Engelke DR Characterization of RPR1, an essential gene encoding the RNA component of Saccharomyces cerevisiae nuclear RNase P. Mol Cell Biol 1991-01-01
Chamberlain JR, Lee Y, Lane WS, Engelke DR Purification and characterization of the nuclear RNase P holoenzyme complex reveals extensive subunit overlap with RNase MRP. Genes Dev 1998-06-01
Houser-Scott F, Xiao S, Millikin CE, Zengel JM, Lindahl L, Engelke DR Interactions among the protein and RNA subunits of Saccharomyces cerevisiae nuclear RNase P. Proc Natl Acad Sci U S A 2002-03-05
Coughlin DJ, Pleiss JA, Walker SC, Whitworth GB, Engelke DR Genome-wide search for yeast RNase P substrates reveals role in maturation of intron-encoded box C/D small nucleolar RNAs. Proc Natl Acad Sci U S A 2008-08-26


Add your own comment!


There are no comments yet.

Last modification of this entry: 2012-07-05 14:55:35
Edited by a user: kaja
Edited content: Changed publications.

Welcome stranger! Click here to login or here to register.