Welcome! Click here to login or here to register.
Home
Pathways
Proteins
Catalytic RNA molecules
Enzymatic complexes
Structures
Publications
Draw a picture
 
Search
 
Links
Help
Contact





Bujnicki Lab Homepage

RMRP

Known also as: Homo sapiens RNA component of mitochondrial RNA processing endoribonuclease, RNase MRP RNA, CHH, NME1, RMRPR, RRP2


NCBI GI number: 292658850 RFAM id: RF00030
Species: Homo sapiens

RNA component of mitochondrial RNA processing endoribonuclease, which cleaves mitochondrial RNA at a priming site of mitochondrial DNA replication.


This RNA also interacts with the telomerase reverse transcriptase catalytic subunit to form a distinct ribonucleoprotein complex that has RNA-dependent RNA polymerase activity and produces double-stranded RNAs that can be processed into small interfering RNA. 

Mutations in this gene are associated with cartilage-hair hypoplasia.

This RNA molecule can be a part of a given complexes: Reactions in which RMRP is involved:
Pathways in which RMRP is involved:

RMRP (Homo sapiens) belongs to following protein families:
RNA sequence:
GGUUCGUGCUGAAGGCCUGUAUCCUAGGCUACACACUGAGGACUCUGUUC
CUCCCCUUUCCGCCUAGGGG AAAGUCCCCGGACCUCGGGCAGAGAGUGC
CACGUGCAUACGCACGUAGACAUUCCCCGCUUCCCACUCCA AAGUCCGC
CAAGAAGCGUAUCCCGCUGAGCGGCGUGGCGCGGGGGCGUCAUCCGUCAG
CUCCCUCUAGUU ACGCAGGCAGUGCGUGUCCGCGCACCAACCACACGGG
GCUCAUUCUCAGCGCGGCUGUAAAAAAAAA


Add your own comment!


There are no comments yet.

Last modification of this entry: April 23, 2012.

Welcome stranger! Click here to login or here to register.