Welcome! Click here to login or here to register.
Home
Pathways
Proteins
Catalytic RNA molecules
Enzymatic complexes
Structures
Publications
Draw a picture
 
Search
 
Links
Help
Contact





Bujnicki Lab Homepage

U3 snoRNA

Known also as: small nucleolar RNA U3, U3, RNU3P2


NCBI GI number: 37551 RFAM id: RF00012
Species: Homo sapiens

 

U3 snoRNA is a non-coding RNA found predominantly in the nucleolus. U3 has C/D box motifs that technically make it a member of the box C/D class of snoRNAs; however, unlike other C/D box snoRNAs, it has not been shown to direct 2'-O-methylation of other RNAs. Rather, U3 is thought to guide site-specific cleavage of ribosomal RNA (rRNA) during pre-rRNA processing.
 
The box C/D element is a subset of the six short sequence elements found in all U3 snoRNAs, namely boxes A, A', B, C, C', and D. The U3 snoRNA secondary structure is characterized by a small 5' domain (with boxes A and A'), and a larger 3'domain (with boxes B, C, C', and D), the two domains being linked by a single-stranded hinge. Boxes B and C form the B/C motif, which appears to be exclusive to U3 snoRNAs, and boxes C' and D form the C'/D motif. The latter is functionally similar to the C/D motifs found in other snoRNAs. The 5' domain and the hinge region act as a pre-rRNA-binding domain. The 3' domain has conserved protein-binding sites. Both the box B/C and box C'/D motifs are sufficient for nuclear retention of U3 snoRNA. The box C'/D motif is also necessary for nucleolar localization, stability and hyper-methylation of U3 snoRNA. Both box B/C and C'/D motifs are involved in specific protein interactions and are necessary for the rRNA processing functions of U3 snoRNA.

This RNA molecule can be a part of a given complexes: Reactions in which U3 snoRNA is involved:
Pathways in which U3 snoRNA is involved:

U3 snoRNA (Homo sapiens) belongs to following protein families:
RNA sequence:
AAGACTATACTTTCAGGGATCATTTCTATAGTGTGTTACTAGAGAAGTTT
CTCTGAACGTGTAGAGCACCGAAAACCACGAGGAAGAGAGGTAGCGTTTT
CTCCTGAGCGTGAAGCCGGCTTTCTGGCGTTGCTTGGCTGCAACTGCCGT
CAGCCATTGATGATCGTTCTTCTCTCCGTATTGGGGAGTGAGAGGGAGAG
AACGCGGTCTGAGTGGT

Keywords:

Add your own comment!


There are no comments yet.

Last modification of this entry: Aug. 2, 2012.

Welcome stranger! Click here to login or here to register.