Welcome! Click here to login or here to register.
Home
Pathways
Proteins
Catalytic RNA molecules
Enzymatic complexes
Structures
Publications
Draw a picture
 
Search
 
Links
Help
Contact





Bujnicki Lab Homepage

NME1


NCBI GI number: 4037 RFAM id: RF00030
Species: Saccharomyces cerevisiae

FUNCTION:

  1. Component of RNase MRP (which cleaves pre-rRNA complexes and mRNA in its 5' untranslated region - UTR)  (PMID: 14729943)
  2. pre-rRNA processing at site A3 in the Interna Transcribed Spacer 1 (ITS1) (participation in synthesis of short form of 5.8S rRNA - 5.8S(S) ) (PMID: 16618965, 9620854,  8247008)
  3. regulation of the cell cycle through the degradation of specific mRNAs (PMID: 14729943) 

This RNA molecule can be a part of a given complexes: Reactions in which NME1 is involved:
Pathways in which NME1 is involved:

NME1 (Saccharomyces cerevisiae) belongs to following protein families:
RNA sequence:
AAUCCAUGACCAAAGAAUCGUCACAAAUCGAAGCUUACAAAAUGGAGUAA
AAUUUUUUUUACUCAGUAAUAUGCUUUGGGUUGAAAGUCUCCCACCAAUU
CGUAUGCGGAAAACGUAAUGAGAUUUAAAAAUUUUAAAUUGUUUAAAUCA
ACUCAUUAAGGAGGAUGCCCUUGGGUAUUCUGCUUCUUGACCUGGUACCU
CUAUUGCAGGGUACUGGUGUUUUCUUCGGUACUGGAUUCCGUUUGUAUGG
AAUCUAAACCAUAGUUAUGACGAUUGCUCUUUCCCGUGCUGGAUCGAGUA
ACCCAAUGGAGCUUACUAUUCUUGGUCCAUGGAUUCACCC

References:

Authors Title Journal
Schmitt ME, Clayton DA Nuclear RNase MRP is required for correct processing of pre-5.8S rRNA in Saccharomyces cerevisiae. Mol Cell Biol 1993-12-01
Chamberlain JR, Lee Y, Lane WS, Engelke DR Purification and characterization of the nuclear RNase P holoenzyme complex reveals extensive subunit overlap with RNase MRP. Genes Dev 1998-06-01
Gill T, Cai T, Aulds J, Wierzbicki S, Schmitt ME RNase MRP cleaves the CLB2 mRNA to promote cell cycle progression: novel method of mRNA degradation. Mol Cell Biol 2004-01-01
Xiao S, Hsieh J, Nugent RL, Coughlin DJ, Fierke CA, Engelke DR Functional characterization of the conserved amino acids in Pop1p, the largest common protein subunit of yeast RNases P and MRP. RNA 2006-06-01


Add your own comment!


There are no comments yet.

Last modification of this entry: 2012-04-20 14:14:09
Edited by a user: kaja
Edited content: No fields changed.

Welcome stranger! Click here to login or here to register.