Welcome! Click here to login or here to register.
Home
Pathways
Proteins
Catalytic RNA molecules
Enzymatic complexes
Structures
Publications
Draw a picture
 
Search
 
Links
Help
Contact





Bujnicki Lab Homepage

M1 RNA


NCBI GI number: 49175990
Species: Escherichia coli

This RNA molecule can be a part of a given complexes: Reactions in which M1 RNA is involved:
Pathways in which M1 RNA is involved:

RNA sequence:
GAAGCUGACCAGACAGUCGCCGCUUCGUCGUCGUCCUCUUCGGGGGAGAC
GGGCGGAGGGGAGGAAAGUC CGGGCUCCAUAGGGCAGGGUGCCAGGUAA
CGCCUGGGGGGGAAACCCACGACCAGUGCAACAGAGAGCAA ACCGCCGA
UGGCCCGCGCAAGCGGGAUCAGGUAAGGGUGAAAGGGUGCGGUAAGAGCG
CACCGCGCGGCU GGUAACAGUCCGUGGCACGGUAAACUCCACCCGGAGC
AAGGCCAAAUAGGGGUUCAUAAGGUACGGCCCG UACUGAACCCGGGUAG
GCUGCUUGAGCCAGUGAGCGAUUGCUGGCCUAGAUGAAUGACUGUCCACG
ACAG AACCCGGCUUAUCGGUCAGUUUCACCU


Add your own comment!


There are no comments yet.

Last modification of this entry: June 19, 2012.

Welcome stranger! Click here to login or here to register.