Welcome! Click here to login or here to register.
Home
Pathways
Proteins
Catalytic RNA molecules
Enzymatic complexes
Structures
Publications
Draw a picture
 
Search
 
Links
Help
Contact





Bujnicki Lab Homepage

H1 RNA

Known also as: Homo sapiens ribonuclease P RNA component H1, RppH1, RNase P RNA


NCBI GI number: 63999351 RFAM id: RF00009
Species: Homo sapiens

H1RNA is the RNA component of the RNase P ribonucleoprotein, an endoribonuclease that cleaves tRNA precursor molecules to form the mature 5-prime termini of their tRNA sequences.

This RNA molecule can be a part of a given complexes: Reactions in which H1 RNA is involved:
Pathways in which H1 RNA is involved:

H1 RNA (Homo sapiens) belongs to following protein families:
RNA sequence:
AUAGGGCGGAGGGAAGCUCAUCAGUGGGGCCACGAGCUGAGUGCGUCCUG
UCACUCCACUCCCAUGUCCC UUGGGAAGGUCUGAGACUAGGGCCAGAGG
CGGCCCUAACAGGGCUCUCCCUGAGCUUCGGGGAGGUGAGU UCCCAGAG
AACGGGGCUCCGCGCGAGGUCAGACUGGGCAGGAGAUGCCGUGGACCCCG
CCCUUCGGGGAG GGGCCCGGCGGAUGCCUCCUUUGCCGGAGCUUGGAAC
AGACUCACGGCCAGCGAAGUGAGUUCAAUGGCU GAGGUGAGGUACCCCG
CAGGGGACCUCAUAACCCAAUUCAGACUACUCUCCUCCGCCCAUU

References:

Authors Title Journal
Marquez SM, Chen JL, Evans D, Pace NR Structure and function of eukaryotic Ribonuclease P RNA. Mol Cell 2006-11-03
Baer M, Nilsen TW, Costigan C, Altman S Structure and transcription of a human gene for H1 RNA, the RNA component of human RNase P. Nucleic Acids Res 1990-02-11


Add your own comment!


There are no comments yet.

Last modification of this entry: 2012-07-05 14:55:44
Edited by a user: kaja
Edited content: Changed publications.

Welcome stranger! Click here to login or here to register.