General Data

RNA Type	unknown
Original Source	Sci-ModoM
Transcript ID:	ENST00000534014
Gene ID:	ENSG00000131871
Gene Name:	SELENOS
Sequence (UNICHARACTER ENCODING)	CGGCGGCAGGGCUGGGCGGCGGCGGCGGCGGCGGUCAUGGAACGCCAAGAGGAGUCUCUGUCCGCGCGGCCGGCCCUGGAGACCGAGGGGCUGCGCUUCCUGCACACCACGGUGGGCUCCCUGCUGGCCACCUAUGGCUGGUACAUCGUCUUCЖGCUGCAPCCUUCUCUACGUGGUCUUUCAGAAGCUUUCCGCCCGGCUAAGAGCCUUGAGGCAGAGGCAGCUGGACCGAGCUGCGGCUGCUGUGGGUUAGUGCCUGAUAACCGAAAUGAAAGCGGUGGUUUUGCACCUCCUUUAUAUUAAGAGUUAGUCUCUUAGUAAAAGUAAGAGGGGCCACACAGGAAGACCCUGUCUCU
Sequence (SHORT NAMES ENCODING)	CGGCGGCAGGGCUGGGCGGCGGCGGCGGCGGCGGUCAUGGAACGCCAAGAGGAGUCUCUGUCCGCGCGGCCGGCCCUGGAGACCGAGGGGCUGCGCUUCCUGCACACCACGGUGGGCUCCCUGCUGGCCACCUAUGGCUGGUACAUCGUCUUCm6AGCUGCAYCCUUCUCUACGUGGUCUUUCAGAAGCUUUCCGCCCGGCUAAGAGCCUUGAGGCAGAGGCAGCUGGACCGAGCUGCGGCUGCUGUGGGUUAGUGCCUGAUAACCGAAAUGAAAGCGGUGGUUUUGCACCUCCUUUAUAUUAAGAGUUAGUCUCUUAGUAAAAGUAAGAGGGGCCACACAGGAAGACCCUGUCUCU
Sequence (MODOMICS CODE ENCODING)	CGGCGGCAGGGCUGGGCGGCGGCGGCGGCGGCGGUCAUGGAACGCCAAGAGGAGUCUCUGUCCGCGCGGCCGGCCCUGGAGACCGAGGGGCUGCGCUUCCUGCACACCACGGUGGGCUCCCUGCUGGCCACCUAUGGCUGGUACAUCGUCUUC2000000006AGCUGCA2000000009UCCUUCUCUACGUGGUCUUUCAGAAGCUUUCCGCCCGGCUAAGAGCCUUGAGGCAGAGGCAGCUGGACCGAGCUGCGGCUGCUGUGGGUUAGUGCCUGAUAACCGAAAUGAAAGCGGUGGUUUUGCACCUCCUUUAUAUUAAGAGUUAGUCUCUUAGUAAAAGUAAGAGGGGCCACACAGGAAGACCCUGUCUCU

Score Table

_{Table containing the score explanation. Score identify the level of experimental reliability and evidence so as exaplained in the 2023 release manuscript. Class 1 should be considered as highlyrelevant. Class 2 evidences are considered as Solid, namely large errors are unlikely and minor errors should not undermine the meaning of data. Class 3 is considered as speculative and errors are expected. Class 4 is considered as questionable. Class 5 evidence means that verification and data are still to be collected. Class 6 data cannot be estimated.}

Method Classification	Score
Multiple direct experimental evidence	1
Direct experimental evidence	2
Inferred based on indirect experimental evidence	3
Predicted computationally	4
Evidence not yet annotated (Unknown)	5
Irrelevant	6

Modification Positions

_{Table containing the original modifications present in the MODOMICS sequences. Edit locations not originally present in the RNA sequences are marked by their source. Their scores are in third row.}

Position in the Sequence	154	161
Modification Positions	m6A	Y
Genomic Coordinates	15:101276634:-	15:101276627:-
Level of Experimental Evidence	3	3
Level of Experimental Reliability	3	3
Source	Sci-ModoM	Sci-ModoM
EUFIDs	834aFpha8RvT dA7YoLwHrzgR JASnTTw2HeNE ksEP666umrV9 NKGM8wdLLrnu ZuM5xpZmNuDL	BtsJQJ3DteUq bXBqJigD9oV3 dknfVe6BK8aP f6YSioLdAWpr oZ9Kp5NX8Hv5 XWZVGdLC6gGJ iezFbUdmY3A6 S9vNeQQYrhac JkWoGWVwjNda Yfn77uLS5tv8