General Data

RNA Type	snoRNA
Original Source	Sci-ModoM
Transcript ID:	ENST00000384416
Gene ID:	ENSG00000207145
Gene Name:	SNORA18
Sequence (UNICHARACTER ENCODING)	GUUGAGGUCUAUCCCGAUGGGGCUUUUCCUGUAGCCUGCACAUCGUUGGAAACGCCUCAUAGAGUAACUCUGUGGUUUUACUPUACUCACAGGACUAUUGUUAGAUCUGUGGGAAGGAAUUACЖAGЖCAGUU
Sequence (SHORT NAMES ENCODING)	GUUGAGGUCUAUCCCGAUGGGGCUUUUCCUGUAGCCUGCACAUCGUUGGAAACGCCUCAUAGAGUAACUCUGUGGUUUUACUYUACUCACAGGACUAUUGUUAGAUCUGUGGGAAGGAAUUACm6AAGm6ACAGUU
Sequence (MODOMICS CODE ENCODING)	GUUGAGGUCUAUCCCGAUGGGGCUUUUCCUGUAGCCUGCACAUCGUUGGAAACGCCUCAUAGAGUAACUCUGUGGUUUUACU2000000009UUACUCACAGGACUAUUGUUAGAUCUGUGGGAAGGAAUUAC2000000006AAG2000000006ACAGUU

Score Table

_{Table containing the score explanation. Score identify the level of experimental reliability and evidence so as exaplained in the 2023 release manuscript. Class 1 should be considered as highlyrelevant. Class 2 evidences are considered as Solid, namely large errors are unlikely and minor errors should not undermine the meaning of data. Class 3 is considered as speculative and errors are expected. Class 4 is considered as questionable. Class 5 evidence means that verification and data are still to be collected. Class 6 data cannot be estimated.}

Method Classification	Score
Multiple direct experimental evidence	1
Direct experimental evidence	2
Inferred based on indirect experimental evidence	3
Predicted computationally	4
Evidence not yet annotated (Unknown)	5
Irrelevant	6

Modification Positions

_{Table containing the original modifications present in the MODOMICS sequences. Edit locations not originally present in the RNA sequences are marked by their source. Their scores are in third row.}

Position in the Sequence	83	124	127
Modification Positions	Y	m6A	m6A
Genomic Coordinates	11:93733515:-	11:93733474:-	11:93733471:-
Level of Experimental Evidence	3	3	3
Level of Experimental Reliability	3	3	3
Source	Sci-ModoM	Sci-ModoM	Sci-ModoM
EUFIDs	BtsJQJ3DteUq bXBqJigD9oV3 dknfVe6BK8aP	3kRDPWwiRCgi L6w2k2VEv4EY	8cMbzB4aD5Se ArijeGVTwYBw KTLz8piFYdwC BtsJQJ3DteUq bXBqJigD9oV3 dknfVe6BK8aP f6YSioLdAWpr Mk6ShCGm6RBJ iezFbUdmY3A6 Yfn77uLS5tv8