DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion  Seq description
Covalent Modification of Amino Acid Side Chains Group 1 - Tyrosine's hydroxyl

Group 2 - 5′-phosphorimidazolide

L: Azido-AYA peptide
R: 5′-phosphorimidazolide-activated DNA oligonucleotide
nucleopeptide linkage Mn2+
Mg2+
Zn2+
N 40
 Buffer conditions
70 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl
 Catalytic region of the DNAzyme
AGGTTGGGGGCGTAGTTGCTTTTGGGCGAATATGCTTGGC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2014 C Chu S K Silverman A generalizable DNA-catalyzed approach to peptide-nucleic acid conjugation. 25056930 10.1002/cbic.201402255 Covalent Modification of Amino Acid Side Chains

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra