DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - H2O


S: AAAGUCUCAUGUACUUAUAUGUUCUAGCGCGGA
hydrolyzed RNA Mn2+
Mg2+
Zn2+
RNA phosphodiester N 40
 Buffer conditions
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl
 Yield (%) kcat/ kobs
80-90 kobs = 0.087 h-1
 Catalytic region of the DNAzyme
CCCTATACAAGTGGGAGGATTAGCCATAGGCGTGGGGCAA
Notes
Partially randomized catalytic region based on 10MD5 sequence

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2013 D J Parker S K Silverman DNA catalysis of a normally disfavored RNA hydrolysis reaction. 23697866 10.1021/ja4032488 RNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2009 M Chandra S K Silverman DNA-catalyzed sequence-specific hydrolysis of DNA None 10.1038/nchembio.201 DNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra