DNAzyme description

 Reaction  Substrates  Metal ion Linkage  Seq description
Covalent Modification of Amino Acid Side Chains L: GGATAATACGXTTCACTGCG
R: 5'-triphosphate RNA
X: X = Ala-Lys-Ala
Mn2+
pyrophosphoramidate N *
 Buffer conditions
50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2, 40 mM MgCl2
 Catalytic region of the DNAzyme
CAACATAAGGGAGGAGCAAATGAAAAATGTCAGGCGCAGTGAGTTTACGG
Notes
The selection aimed at the isolation of DNA catalysts capable of modifying Lys using the 3HJ preorganized architecture. However, the in vitro selection resulted in a DNA-catalyzed reaction between a phosphoramidate functional group in the substrate and 5′-triphosphate-RNA, forming an unusual pyrophosphoramidate linkage. The pool is N<sub>33</sub>-CGCAGTGAG-N<sub>7</sub>.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2012 A Sachdeva S K Silverman DNA-catalyzed reactivity of a phosphoramidate functional group and formation of an unusual pyrophosphoramidate linkage. 22042295 10.1039/c1ob06088k Covalent Modification of Amino Acid Side Chains

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra