| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
S: CTCTATCTATrAGGAAGTACCGCCGC |
specific cleavage at desired position |
Na+ |
RNA phosphodiester | N * |
|---|
| Buffer conditions |
|---|
| * |
| Yield (%) | kcat/ kobs |
|---|---|
| >80 | kobs = 0.1 min-1 |
| Catalytic region of the DNAzyme |
|---|
| GCGGCGGTACCAGGTCAAAGGTGGGTGAGGGGACGCCAAGAGTCCCCGCGGTTAGATAGAG |
| Notes |
|---|
| Truncated DNAzymes derived from NaA43 (trans-cleaving) |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2015 | S-F Torabi | Y Lu | In vitro selection of a sodium-specific DNAzyme and its application in intracellular sensing | None | 10.1073/pnas.1420361112 | RNA cleavage |