DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
DNA cleavage Group 1 - H2O


S: *
hydrolyzed DNA Zn2+
DNA phosphodiester N 100*
 Buffer conditions
50 mM HEPES pH 7.0 , 100 mM NaCl, 20 mM MgCl2, 2 mM ZnCl2
 Yield (%) kcat/ kobs
>90 kobs = 1 min-1
 Catalytic region of the DNAzyme
AGTCAGAAAGATAATCTAGTTGAGCTGTCTGCATCACGAG-CTCGTGATGCAGACGTTGAAGGATTATCTTTCTGACT
Notes
Members of the single-stranded DNA pool contain two 15 nt primer binding sites (5′ and 3′ termini) and two 50 nt random-sequence domains linked by a 15 nt bridge (middle). They are 145 nt-long. Self hydrolyzing.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2013 H Gu R R Breaker Small, highly active DNAs that hydrolyze DNA. 23679108 10.1021/ja403585e DNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra