DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rU

Group 2 - vicinal phosphate

S: AAAAGUAACUAGAGAUGG
specific cleavage at desired position Mg2+
RNA phosphodiester N *
 Buffer conditions
1 M NaCl, 50 mM Tris-HCl pH 7.5, 10 mM MgCl2
 kcat/ kobs
kobs = 0.015 min-1 and 0.0027 min-1 towards RNA substrates with UU and UA cleavage site junctions, respectively.
 Catalytic region of the DNAzyme
CATTTCTCGCTTTGCTGGATGTTACTTTT
Notes
Optimization of 10–12 catalytic core for improved activity.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2019 Y Wang H Yu A Novel Small RNA-Cleaving Deoxyribozyme with a Short Binding Arm None 10.1038/s41598-019-44750-x RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra