DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position Zn2+
RNA phosphodiester N 40
 Buffer conditions
500 mM NaCl, 50 mM HEPES pH 7.0, ZnCl2 0.1 µM
 Catalytic region of the DNAzyme
CACCTCGAAGACCCGCGTTGCACCTGATCAGTTGGGGCCATCCTTGTGACG
Notes
The annotated sequence contains 3' and 5' conserved regions in addition to the N<sub>40</sub> region.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2005 K E Nelson Y Lu In vitro selection of high temperature Zn(2+)-dependent DNAzymes. 16096680 10.1007/s00239-004-0374-3 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra