DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

specific cleavage at desired position Gd3+
RNA phosphodiester N 50
 Buffer conditions
10 µM Gd3+, 50 mM MES pH 6.0, 25 mM NaCl
 kcat/ kobs
kobs = 0.012 min-1
 Catalytic region of the DNAzyme
TCGCCATCTTGACGCATATCGTTTTCGATAGCACGTGTTAGTGACTCGT
Notes
Truncated version of Gd2.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 P-J J Huang J Liu Distinction of Individual Lanthanide Ions with a DNAzyme Beacon Array None 10.1021/acssensors.6b00239 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra