DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position Ho3+
RNA phosphodiester N 35
 Buffer conditions
50 mM MES pH 6.0, 25 mM NaCl, 10 µM Ho3+
 Catalytic region of the DNAzyme
CTGCAGAATTCTAATACGAGTCACTATAGGAAGATGGCGAAACATCTTATATGATATCTTTTAACGAGTATTAAACCATAAGATAGTCGGTAAGCTTG

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2015 P-J J Huang J Liu A new heavy lanthanide-dependent DNAzyme displaying strong metal cooperativity and unrescuable phosphorothioate effect. 25488814 10.1093/nar/gku1296 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra