DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: GTCACGAGTCACTATrAGGAAGATGGCGAAA
specific cleavage at desired position Sm3+
RNA phosphodiester N 50
 Buffer conditions
50 mM MES pH 6.0, 25 mM NaCl, Ln3+
 kcat/ kobs
kobs = 0.6 min-1
 Catalytic region of the DNAzyme
TTTCGCCATCTTTATTGCGTAAAGCATCAGTTTTCTGATACAAGGATAGTGACTCGTGAC
Notes
Trans-cleaving format derived from Dy10.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 P-J J Huang J Liu In Vitro Selection of a DNAzyme Cooperatively Binding Two Lanthanide Ions for RNA Cleavage. 27054549 10.1021/acs.biochem.6b00132 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra