| Reaction | Reacting groups | Substrates | Product | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rG Group 2 - vicinal phosphate |
S: cleavage in cis |
specific cleavage at desired position | RNA phosphodiester | N 50 |
|---|
| Buffer conditions |
|---|
| 100 mM KCl, 300 mM NaCl, 15 mM MnCl2, 15 mM MgCl2, 55 mM HEPES pH 7.5 |
| Catalytic region of the DNAzyme |
|---|
| ATCTTTTCTATCAACCCCAAAACTTTGGCACAATGAAGTGGGTGACTTTT |
| Notes |
|---|
| The starting sequence for the experiment was chose at random, and corresponds to the first 50 nucleotides of the Bos taurus (cattle) albumin gene. The goal in this case was to evolve a catalytic sequence from a non-catalytic one. Trans-cleaving versions of G2501 were also active. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2015 | Rachel Gysbers | Y Li | Evolution of an Enzyme from a Noncatalytic Nucleic Acid Sequence. | 26091540 | 10.1038/srep11405 | RNA cleavage |