DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position Mg2+-independent
RNA phosphodiester N 40
 kcat/ kobs
kobs = 0.049 h-1
 Catalytic region of the DNAzyme
ACACGCACGGACTTGTACGTATATAGCGTAAGGTTGATAG
Notes
The initial library was based on the sequence used by Breaker and Joyce (Breaker, R. R., and Joyce, G. F. (1995) A DNA enzyme with Mg2+-dependent RNA phosphoesterase activity, Chem. Biol. 2, 655-660) with an internal riboadenosine incorporated at position 28 to provide a cleavable linker.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2004 M A Carrigan S A Benner Quantitative analysis of a RNA-cleaving DNA catalyst obtained via in vitro selection. 15350131 10.1021/bi049898l RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra