DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of L-rA

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position metal ion dependency not reported
RNA phosphodiester* N 50
 Buffer conditions
10 mM MgCl2, 0.5 M NaCl, 50 mM EPPS pH 7.5
 Catalytic region of the DNAzyme
GCTGATCGTCCCAGACATGCATAGTCCAACTCTCCCTGACACCCTTAGCA
Notes
Cleaves a 3′,5′-linked beta-L-ribonucleotide.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2002 P Ordoukhanian G F Joyce RNA-cleaving DNA enzymes with altered regio- or enantioselectivity. 12381192 10.1021/ja027467p RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra