DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rG

Group 2 - vicinal phosphate

S: cleavage in cis
specific cleavage at desired position Mn2+
RNA phosphodiester N 80
 Buffer conditions
50 mM HEPES pH 7.0, 400 mM NaCl, 100 mM KCl, 7.5 mM MnCl2, 50 µM CuCl2, 7.5 mM MgCl2
 Catalytic region of the DNAzyme
ACCTCAATAGCAGCGTTAACAAAAAGTTTCGAGAAAGCGAATCATCTAACGGTGGTGACTCCATTGGTTTTTTGGGTGGG
Notes
Appears to contain a variant of the 8-17 motif close to the 5′ end.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2004 K Schlosser Y Li Tracing sequence diversity change of RNA-cleaving deoxyribozymes under increasing selection pressure during in vitro selection. 15274624 10.1021/bi049757j RNA cleavage

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2006 K Schlosser Y Li Characterization of long RNA-cleaving deoxyribozymes with short catalytic cores: the effect of excess sequence elements on the outcome of in vitro selection. 16682452 10.1093/nar/gkl276 RNA cleavage
1997 S W Santoro G F Joyce A general purpose RNA-cleaving DNA enzyme. 9113977 10.1073/pnas.94.9.4262 RNA cleavage
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra