DNAzyme description

 Reaction  Substrates Product  Seq description
Porphyrin metalation S: mesoporphyrin IX (MPIX)
Cu-MPIX N 30
 Catalytic region of the DNAzyme
AGCCCTGCTGCATTGCAACCAGGGGGTGGGCGTACCAGCAGGGCT
Notes
Selected as aptamers for NMM, can catalyze the insertion of several divalent metal ions into MPIX. Nm2-hemin complex displayed a DNA-enhanced peroxidase activity with the substrate of ABTS.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2019 L Yang R Pei Exploration of Catalytic Nucleic Acids on Porphyrin Metalation and Peroxidase Activity by in Vitro Selection of Aptamers for N-Methyl Mesoporphyrin IX. 30602113 10.1021/acscombsci.8b00129 Porphyrin metalation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra