DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: trans-cleaving
specific cleavage at desired position Pb2+
RNA phosphodiester N 35
 Buffer conditions
60 µM Pb2+, 50 mM MES pH 6.0, 25 mM NaCl
 Catalytic region of the DNAzyme
AAGCATGGAAGCAAAGAAGGCACC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2015 R Saran J Liu Searching for a DNAzyme Version of the Leadzyme. 26458991 10.1007/s00239-015-9702-z RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra