| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA cleavage |
Group 1 - 2'-OH of rA Group 2 - vicinal phosphate |
X: Fluorescein (F)- and a DABCYL (Q)-modified deoxyribothymidine. S: cleavage in cis |
specific cleavage at desired position |
TcdC‐24 protein |
RNA phosphodiester | N 40 |
|---|
| Catalytic region of the DNAzyme |
|---|
| GATCTGAGTGGATTGGGGCCTGCGCGGAGTCGGGACTATT |
| Notes |
|---|
| The DNAzyme catalyzes the cleavage ligation solely in the presence of crude extracellular mixture (CEM) of Clostridium difficile. The tcdC-24 protein seems to be responsible for the DNAzyme's activation. It is a flourogenic probe for the detection of this bacterium. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2016 | Z Shen | Y Li | A Catalytic DNA Activated by a Specific Strain of Bacterial Pathogen. | 26676768 | 10.1002/anie.201510125 | RNA cleavage |