| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA ligation |
Group 1 - internal 2'-OH Group 2 - 5'-triphosphate |
L: GGAAGUCUCAUGUACUAACA R: GUAUGUUCUAGCGCGGA |
branched RNA |
Mn2+ |
A18 | N 40 |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 20 mM MnCl2 |
| Catalytic region of the DNAzyme |
|---|
| CAGGGGGAGCGAGCACTAATACAAGCGGGTAGGAGGCCCT |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2005 | Y Wang | S K Silverman | Directing the outcome of deoxyribozyme selections to favor native 3'-5' RNA ligation. | 15723545 | 10.1021/bi0478291 | RNA ligation |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2005 | Y Wang | S K Silverman | Efficient one-step synthesis of biologically related lariat RNAs by a deoxyribozyme. | 16086354 | 10.1002/anie.200501643 |
RNA ligation |