DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 2',3'-cyclic phosphate

Group 2 - 5'-OH

L: UAAUACGACUCACUAUA
R: GGAAGAGAUGGCGACGG
non-native RNA Mg2+
2',5' N 20
 Buffer conditions
50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40mM MgCl2
 Yield (%) kcat/ kobs
10-15 kobs = 0.32 (h-1)
 Catalytic region of the DNAzyme
TTCTGCGCAGGTAAGCTGTA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2003 A Flynn-Charlebois S K Silverman In vitro evolution of an RNA-cleaving DNA enzyme into an RNA ligase switches the selectivity from 3'-5' to 2'-5'. 12720447 10.1021/ja0340331 RNA ligation

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2003 B L Ricca S K Silverman Optimization and generality of a small deoxyribozyme that ligates RNA. 12860124 10.1016/S0022-2836(03)00654-5 RNA ligation
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra