DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 2',3'-cyclic phosphate

Group 2 - 5'-OH

L: UAAUACGACUCACUAUA
R: GGAAGAGAUGGCGACGG
non-native RNA Mg2+
2',5' N 40
 Buffer conditions
50 mM HEPES pH 7.5, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2
 Yield (%) kcat/ kobs
40-60 kobs = 0.39 (h-1) at pH 7.5, kobs = 0.065 (min-1) at pH 9.0
 Catalytic region of the DNAzyme
CTTTACGGTAGGGTGCCTGTGATAATGATCAGGGGACGGC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2003 A Flynn-Charlebois S K Silverman Deoxyribozymes with 2'-5' RNA ligase activity. 12603132 10.1021/ja028774y RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra