| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA ligation |
Group 1 - 2',3 '- diol Group 2 - 5'-triphosphate |
L: GGAAGUCUCAUGUACUA R: GAUGUUCUAGCGCCGGA |
native RNA |
Mg2+ |
3',5' | N 40 |
|---|
| Buffer conditions |
|---|
| 50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2 |
| Yield (%) | kcat/ kobs |
|---|---|
| 60-70 | kobs = 0.2 (h-1) at pH 7.5, kobs = 0.036 (min-1) at pH 9.0 |
| Catalytic region of the DNAzyme |
|---|
| GGATCATACGGTCGGAGGGGTTTGCCGTGAACATTCTTCA |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2005 | W E Purtha | S K Silverman | General deoxyribozyme-catalyzed synthesis of native 3'-5' RNA linkages. | 16173722 | 10.1021/ja0533702 | RNA ligation |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2016 | A Ponce-Salvatierra | V Pena | Crystal structure of a DNA catalyst. | 26735012 | 10.1038/nature16471 |
RNA ligation |
| 2011 | F Wachowius | C Höbartner | Probing essential nucleobase functional groups in aptamers and deoxyribozymes by nucleotide analogue interference mapping of DNA. | 21863810 | 10.1021/ja205894w |
RNA ligation |
| 2010 | F Wachowius | C Höbartner | Combinatorial mutation interference analysis reveals functional nucleotides required for DNA catalysis. | 20872387 | 10.1002/anie.201003940 |
RNA ligation |
| 2019 | E J Mattioli | M Calvaresi | DNAzymes at Work: A DFT Computational Investigation on the Mechanism of 9DB1 | None | 10.1021/acs.jcim.8b00815 |
RNA ligation |