DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 2',3 '- diol

Group 2 - 5'-triphosphate

L: GGAAGUCUCAUGUACUA
R: GAUGUUCUAGCGCCGGA
native RNA Zn2+
3',5' N 40
 Buffer conditions
70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2
 Yield (%) kcat/ kobs
40-50 kobs = 0.02 (min-1) at pH 7.5
 Catalytic region of the DNAzyme
GTAGGGTTGGTAGACCAGGTTGAGCCGGCGTCCTTGTTTA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2005 W E Purtha S K Silverman General deoxyribozyme-catalyzed synthesis of native 3'-5' RNA linkages. 16173722 10.1021/ja0533702 RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra