DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 2',3'-cyclic phosphate

Group 2 - 5'-OH

L: UAAUACGACUCACUAUA
R: GGAAGAGAUGGCGACGG
native RNA Zn2+
3',5' N 40
 Buffer conditions
70 mM Tris pH 7.5, 150 mM NaCl, 2 mM KCl, 1 mM ZnCl2
 Yield (%) kcat/ kobs
35/17 for R substrates with 5'-dG and G, respectively. kobs = 0.020/0.013 min-1 for R substrates with 5'-dG and G, respectively.
 Catalytic region of the DNAzyme
CAGCGCGATTGAGTGCGTGATTGAAGCTCGGGGTTGGTTA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2005 K A Hoadley S K Silverman Zn2+-dependent deoxyribozymes that form natural and unnatural RNA linkages. 15966746 10.1021/bi050146g RNA ligation

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2008 D M Kost S K Silverman Controlling the direction of site-selectivity and regioselectivity in RNA ligation by Zn2+-dependent deoxyribozymes that use 2',3'-cyclic phosphate RNA substrates. 19005599 10.1039/B813566E RNA ligation
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra