DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 2',3'-diol

Group 2 - 5'-triphosphate

L: UAAUACGACUCACUAUA
R: GGAAGAGAUGGCGACGG
native RNA Mg2+
3',5' N 38
 Buffer conditions
50 mM CHES pH 9.0, 150 mM NaCl, 2 mM KCl, 40 mM MgCl2
 Catalytic region of the DNAzyme
CACAAGGGAACAGGCTGCGTGTGAGAGAGTCGCGGTAA

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2004 R L Coppins S K Silverman Rational modification of a selection strategy leads to deoxyribozymes that create native 3'-5' RNA linkages. 15600344 10.1021/ja045817x RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra