| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | RNA ligation |
Group 1 - internal 2'-OH Group 2 - 5'-triphosphate |
L: GGAUAAUACGACUCACUGCG R: GGAAGAGAUGGCGACGG |
branched RNA |
Mn2+ |
A11 | N * |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.5, 20 mM MnCl2, 150 mM NaCl, 2 mM KCl |
| Catalytic region of the DNAzyme |
|---|
| CCCACCGGTAGGGCTACGGGCAAGGTCAACATGCCGCAAGTGAGGGGTCGA |
| Notes |
|---|
| Pool N33-CGCAGTGAG-N7 |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2011 | C S Lee | S K Silverman | Improved deoxyribozymes for synthesis of covalently branched DNA and RNA. | 20739352 | 10.1093/nar/gkq753 | RNA ligation |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2008 | T P Mui | S K Silverman | Convergent and general one-step DNA-catalyzed synthesis of multiply branched DNA. | 18808125 | 10.1021/ol801568q |
DNA ligation |