DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA ligation Group 1 - 2',3'-cyclic phosphate

Group 2 - 5'-OH

L: UAAUACGACUCACUAUA
R: GGAAGAGAUGGCGACGG
non-native RNA Mg2+
2',5' N 40
 Buffer conditions
50 mM CHES pH 9.0, 40 mM MgCl2
 Yield (%) kcat/ kobs
25-35 kobs = 0.2-0.3 h-1
 Catalytic region of the DNAzyme
GGCGTTAAGGATTGGCGGAAACGGGTGGATCGCGGACC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2005 D R Semlow S K Silverman Parallel selections in vitro reveal a preference for 2'-5' RNA ligation upon deoxyribozyme-mediated opening of a 2',3'-cyclic phosphate. 16007488 10.1007/s00239-004-0326-y RNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra