DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
RNA cleavage Group 1 - 2'-OH of rA

Group 2 - vicinal phosphate

S: GGGACGAATTCTAATACGACTCACTATrAGGAAGAGATGGCGAC
specific cleavage at desired position, likely resulting in 5' product with a terminal 2',3'-cyclic phosphate, and a 3' product with a 5'-OH Pb2+
RNA phosphodiester N 50
 Buffer conditions
0.5 M NaCl, 0.5 M KCl, 50 mM MgCl2, 50 mM HEPES pH 7.0, 1 mM PbOAc
 Catalytic region of the DNAzyme
TTGCCCAGCATAGTCGGCAGACGTGGTGTTAGCGACACGATAGGCCCGGT
Notes
Cleave at single ribont embedded in the otherwise all-DNA substrate, name given by me in order to differentiate from other clones reported in the paper

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1994 R R Breaker G F Joyce A DNA enzyme that cleaves RNA. 9383394 10.1016/1074-5521(94)90014-0 RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra