DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
DNA ligation Group 1 - 3'-phosphorimidazolide

Group 2 - 5'-OH

L: AAGCATCTCAAGC
R: GGAACACTATCCG
activated substrate ligated to the ss DNA pool Zn2+
phosphodiester N 116
 Buffer conditions
30 mM HEPES pH 7.4, 600 mM KCl, 50 mM MgCl2, 1 mM ZnCl2
 Catalytic region of the DNAzyme
TATAGTCAGGCTGGTAGGGTTCTTTCGCAGAGTGCGATGTGTTTTGATTTGAACTTATTTATGAGGTCGGTTGAAGCTCATTGCGACTGAGTGCTTGCTGCTTGTTACTTTCCCAC
Notes
R is the 5' pool's constant region, therefore connected to the N116

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
1995 B Cuenoud J W Szostak A DNA metalloenzyme with DNA ligase activity. 7791880 10.1038/375611a0 DNA ligation

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra