DNAzyme description

 Reaction  Reacting groups  Substrates Product  Seq description
RNA cleavage Group 1 - 2'-OH

Group 2 - vicinal phosphate

X: F = fluorescein-dT, Q = DABCYL-dT
S: GATGTGTCCGTGCFrAQGGTTCGA
cleavage of single ribonucleotide phosphodiester N 70
 Buffer conditions
400 mM NaCl, 100 mM KCl, 8.5 mM MgCl2, 5 mM MnCl2, 1.25 mM CdCl2, 0.25 mM NiCl2, citrate pH 3.0
 Catalytic region of the DNAzyme
GAAGTGGGGGTCGGGGGAAGGGAGGCACGCGTAAAGGTAGGTGTGAGGGCGGGTGAGAGTTGGACAAT
Notes
Evolved from a population initially selected at pH 4.0. Also appeared in pH4, pH5, pH6 pools as pH4DZ7, pH5DZ5 and pH6DZ3

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2003 Z Liu Y Li Assemblage of signaling DNA enzymes with intriguing metal-ion specificities and pH dependences. 12812493 10.1021/ja035208+ RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra