DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Seq description
RNA cleavage Group 1 - 2'-OH

Group 2 - vicinal phosphate

X: F = fluorescein-dT, Q = DABCYL-dT
S: GATGTGTCCGTGCFrAQGGTTCGA
cleavage of single ribonucleotide phosphodiester N 70
 Buffer conditions
400 mM NaCl, 100 mM KCl, 8.5 mM MgCl2, 5 mM MnCl2, 1.25 mM CdCl2, 0.25 mM NiCl2, MES pH 6.0
 Catalytic region of the DNAzyme
TCGTAAGGGGGGAAGGTTGGGTGGAGGGAGTCAGTAAGACGATTGTACTAGTGGTGAGGGCAGGATGATG
Notes
Evolved from a population initially selected at pH 4.0. Also appeared in pH5 pool as pH5DZ6

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2003 Z Liu Y Li Assemblage of signaling DNA enzymes with intriguing metal-ion specificities and pH dependences. 12812493 10.1021/ja035208+ RNA cleavage

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra