DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Seq description
DNA capping Group 1 - DNA 5'-PO4-2 oxygen

Group 2 - ATP

S: GGAAGAGATGCAT-N70-AGCTGATCCTGATGG
5',5'-AppDNA N 70
 Buffer conditions
50 mM HEPES pH 7.0, 400 mM NaCl, 100 mM KCl, 10 mM MgCl2, 5 mM CaCl2, 1 mM MnCl2, and 50 µM CuCl2, 1mM ATP
 Catalytic region of the DNAzyme
AACAGAACTAACTGAAAACGGGGGAAGGCCGTGAGCGGTTATCTTGTTGGTGATGTCTATTGTTACCC

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2000 Y Li R R Breaker Capping DNA with DNA. 10715132 10.1021/bi992710r DNA capping

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra