DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
Ester hydrolysis Group 1 - H2O


S: Ester
Carboxylic acid Mg2+
ester N 40
 Buffer conditions
50 mM CHES pH 9.0, 40 mM MgCl2,150 mM NaCl
 Yield (%) kcat/ kobs
80 kobs = 0.56 h-1
 Catalytic region of the DNAzyme
GGGGCAGCGAGCGTAAGCTGGGGGACCTGCTATTAGCTGC
Notes
The ester substrate is covalently attached to a DNA anchor oligonucleotide.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2013 B M Brandsen S K Silverman DNA-catalyzed hydrolysis of esters and aromatic amides. 24127695 10.1021/ja4077233 Ester hydrolysis

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra