| Reaction | Reacting groups | Substrates | Product | Metal ion | Linkage | Seq description | DNA cleavage |
Group 1 - H2O |
S: AAAGTCTCATGTACTTATATGTTCTAGCGCgga |
hydrolyzed DNA |
Mn2+ Zn2+ |
DNA phosphodiester | N 40 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES (Varying pH: 7.2, 7.5 or 7.8), 20 mM MnCl2, 1 mM ZnCl2, 150 mM NaCl |
| Yield (%) | kcat/ kobs |
|---|---|
| >75 | kobs = 1.43 h-1 |
| Catalytic region of the DNAzyme |
|---|
| CGATAGATAAGTGGGAGCCTTTGCCATAGTTGTCCCTCAA |
| Notes |
|---|
| Partially randomized catalytic region based on 10MD5 sequence |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2010 | Y Xiao | S K Silverman | Functional compromises among pH tolerance, site specificity, and sequence tolerance for a DNA-hydrolyzing deoxyribozyme. | 20923239 | 10.1021/bi1013672 | DNA cleavage |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2011 | Y Xiao | S K Silverman | Merely two mutations switch a DNA-hydrolyzing deoxyribozyme from heterobimetallic (Zn2+/Mn2+) to monometallic (Zn2+-only) behavior. | 21125108 | 10.1039/c0cc04575f |
DNA cleavage |