DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion Linkage  Seq description
Amide hydrolysis Group 1 - H2O


S: *Amide substrate embedded within DNA oligonucleotide complementary to the DNAzyme's binding arms.
Carboxylic acid Mn2+
Mg2+
Zn2+
C-N bond N 40
 Buffer conditions
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl
 Yield (%) kcat/ kobs
10-17 kobs = 0.03-0.04 h-1
 Catalytic region of the DNAzyme
AACGCAGAGGTTAGCACGAACTAGTCAGCGCGGGGATTGA
Notes
* The amide substrate was prepared by solution-phase coupling of a 3'-CO<sub>2</sub>H oligonucleotide and a 5'-amino-5'-deoxythymidine oligonucleotide. For further details, please see the supplementary material of the publication. All dT nucleotides in the catalytic region of the DNAzyme are 5'-substituted 2'-deoxyuridine derivatives (<sup>COOH</sup>dU).

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2016 C Zhou S K Silverman DNA-Catalyzed Amide Hydrolysis. 26854515 10.1021/jacs.5b12647 Amide hydrolysis

Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra