| Reaction | Reacting groups | Substrates | Product | Metal ion | Seq description | Tyrosine Phosphorylation |
Group 1 - Tyrosine's hydroxyl Group 2 - 5'-triphosphate |
L: DNA-anchored CAAYAA hexapeptide R: 5′-triphosphorylated RNA oligonucleotide |
Phosphotyrosine |
Zn2+ |
N 30 |
|---|
| Buffer conditions |
|---|
| 70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl |
| Yield (%) | kcat/ kobs |
|---|---|
| 70 | kobs = 1.42 h-1 |
| Catalytic region of the DNAzyme |
|---|
| GGGGACAGGCAGCTCCACCGATGGGCACCG |
| Notes |
|---|
| Does not discriminate among peptide substrates on the basis of the amino acid identities near the reactive tyrosine residue. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2013 | S M Walsh | S K Silverman | DNA catalysts with tyrosine kinase activity. | 24066831 | 10.1021/ja407586u | Tyrosine Phosphorylation |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2015 | S M Walsh | S K Silverman | Identification of Sequence-Selective Tyrosine Kinase Deoxyribozymes. | 26407964 | 10.1007/s00239-015-9699-3 |
Tyrosine Phosphorylation |
| 2016 | C Chu | S K Silverman | Assessing histidine tags for recruiting deoxyribozymes to catalyze peptide and protein modification reactions. | 27138704 | 10.1039/c6ob00716c |
Tyrosine Phosphorylation Covalent Modification of Amino Acid Side Chains |