DNAmoreDB - A Database of Deoxyribozymes

DNAzyme description

 Reaction  Reacting groups  Substrates Product  Metal ion  Seq description
Tyrosine Phosphorylation Group 1 - Tyrosine's hydroxyl

Group 2 - 5'-triphosphate

L: DNA-anchored CADPYDQS octapeptide
R: 5′-triphosphorylated RNA oligonucleotide
Phosphotyrosine Mn2+
Mg2+
Zn2+
N 40
 Buffer conditions
70 mM HEPES pH 7.5, 1 mM ZnCl2, 20 mM MnCl2, 40 mM MgCl2, 150 mM NaCl
 Yield (%) kcat/ kobs
<10 kobs = 0.05 h-1
 Catalytic region of the DNAzyme
GTGGGCGACGATACCAAGGTCAGGACCCTGGTAGAGCCGC
Notes
The peptide sequence dependence was examined in detail. Motifs could not be assigned with confidence due to the low reaction yields.

 Reported in...

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2015 S M Walsh S K Silverman Identification of Sequence-Selective Tyrosine Kinase Deoxyribozymes. 26407964 10.1007/s00239-015-9699-3 Tyrosine Phosphorylation

 Related Publications

Year of Publication First Author Laboratory Title PubMed ID DOI Reaction
2013 S M Walsh S K Silverman DNA catalysts with tyrosine kinase activity. 24066831 10.1021/ja407586u Tyrosine Phosphorylation
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra