| Reaction | Reacting groups | Substrates | Metal ion | Seq description | Covalent Modification of Phosphorylated Amino Acid Side Chains |
Group 1 - Phosphorylated amino acid Group 2 - 5'-triphosphate |
L: DNA-anchored AAAXAA hexapeptide R: 5′-triphosphorylated RNA oligonucleotide X: X = phosphotyrosine (YP) or phosphoserine (SP) |
Mn2+ Mg2+ |
N 40 |
|---|
| Buffer conditions |
|---|
| 50 mM HEPES pH 7.5, 40 mM MgCl2, 20 mM, MnCl2, 150 mM NaCl, 2 mM KC |
| Yield (%) | kcat/ kobs |
|---|---|
| 40 | kobs = 0.15 h-1 |
| Catalytic region of the DNAzyme |
|---|
| GGACACGATGAGTGACTAAGTGGAATGAGGAAAGCACGAG |
| Notes |
|---|
| The 8VM1 and 8VP1 deoxyribozymes covalently modify phosphotyrosine and phosphoserine. |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2012 | A Sachdeva | S K Silverman | Covalent tagging of phosphorylated peptides by phosphate-specific deoxyribozymes. | 22315198 | 10.1002/cbic.201200048 | Covalent Modification of Phosphorylated Amino Acid Side Chains |
| Year of Publication | First Author | Laboratory | Title | PubMed ID | DOI | Reaction |
|---|---|---|---|---|---|---|
| 2014 | V Dokukin | S K Silverman | A modular tyrosine kinase deoxyribozyme with discrete aptamer and catalyst domains. | 25000337 | 10.1039/c4cc04253k |
Tyrosine Phosphorylation |