Published on 2015 in J. Am. Chem. Soc. volume 137 issue 30.

PubMed ID: 26200899

DOI:10.1021/jacs.5b06308

Abstract:

Dehydroalanine (Dha) is a nonproteinogenic electrophilic amino acid that is a synthetic intermediate or product in the biosynthesis of several bioactive cyclic peptides such as lantibiotics, thiopeptides, and microcystins. Dha also enables labeling of proteins and synthesis of post-translationally modified proteins and their analogues. However, current chemical approaches to introducing Dha into peptides have substantial limitations. Using in vitro selection, here we show that DNA can catalyze Zn2+ or Zn2+/Mn2+-dependent formation of Dha from phosphoserine (pSer), i.e., exhibit pSer lyase activity, a fundamentally new DNA-catalyzed reaction. Two new pSer lyase deoxyribozymes, named Dha-forming deoxyribozymes 1 and 2 (DhaDz1 and DhaDz2), each function with multiple turnover on the model hexapeptide substrate that was used during selection. Using DhaDz1, we generated Dha from pSer within an unrelated linear 13-mer peptide. Subsequent base-promoted intramolecular cyclization of homocysteine into Dha formed a stable cystathionine (thioether) analogue of the complement inhibitor compstatin. These findings establish the fundamental catalytic ability of DNA to eliminate phosphate from pSer to form Dha and suggest that with further development, pSer lyase deoxyribozymes will have broad practical utility for site-specific enzymatic synthesis of Dha from pSer in peptide substrates.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
DhaDz1 ACAGGTGGCGGATGTAGTTTACCCGTTTTCTGTAGAGCC      39 Covalent Modification of Phosphorylated Amino Acid Side Chains
DhaDz2 ACAGGATTCAAAGTGGCTGTCAGAAGTTGGTGAGGGAAG      39 Covalent Modification of Phosphorylated Amino Acid Side Chains
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra