Published on 2000 in Proc. Natl. Acad. Sci. U.S.A. volume 97 issue 14.

PubMed ID: 10884411

DOI:10.1073/pnas.97.14.7802

Abstract:

In vitro evolution was used to develop a DNA enzyme that catalyzes the site-specific depurination of DNA with a catalytic rate enhancement of about 106-fold. The reaction involves hydrolysis of the N-glycosidic bond of a particular deoxyguanosine residue, leading to DNA strand scission at the apurinic site. The DNA enzyme contains 93 nucleotides and is structurally complex. It has an absolute requirement for a divalent metal cation and exhibits optimal activity at about pH 5. The mechanism of the reaction was confirmed by analysis of the cleavage products by using HPLC and mass spectrometry. The isolation and characterization of an N-glycosylase DNA enzyme demonstrates that single-stranded DNA, like RNA and proteins, can form a complex tertiary structure and catalyze a difficult biochemical transformation. This DNA enzyme provides a new approach for the site-specific cleavage of DNA molecules.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
10-28 TGGCGACTACAAAGATATTCTCGGGCAGTTAATGCTTATTGATATCTC      48 DNA depurination
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra