Abstract:
The mercury project: A self‐cleaving DNAzyme that “switches on” in the presence of Hg2+ has been revealed by in vitro selection. The enzyme 10‐13 (see picture) utilizes two modified nucleobases to confer an RNaseA‐like catalytic activity that requires only Hg2+ and no other divalent metal cofactor. This DNAzyme is highly selective for mercuric cations.
DNAzymes linked to this article:
| Name | Isolated sequence | Length | Reaction |
|---|---|---|---|
| 10-3 | CACAGUGUGUGAGGCACUGUACGGUGAGUGGUGCUU | 36 | RNA cleavage |
| 10-5 | UUCUCAUCCGUAGUGAGGGACGCGGCGCUCCCCCGUU | 37 | RNA cleavage |
| 10-8 | CAUAGUGCGUGAGGCCCGCCCACUCCCCGUCGUGGUA | 37 | RNA cleavage |
| 10-9 | UUCUCAUCCGUAGUGAGGGACGCGGCGCUCCCCCGUU | 37 | RNA cleavage |
| 10-10 | GCACAGUGUGUGAGGCAUGUGCGAGUGUGCUGUCUCG | 37 | RNA cleavage |
| 10-13 | CACACGUGUGUGACGGCCUCGCGCGCCCGCCCUGCCGUA | 39 | RNA cleavage |
| 10-17 | CAUAGUGCGUGAGGCGCGUCUGCAGCGUGGUGGGUUU | 37 | RNA cleavage |
| 10-21 | CACAGUUGUGUGAUGGCUGGGCAGCCAGCGGUGGUCA | 37 | RNA cleavage |
| 10-24 | CAUAGUGCGUGAGGCUUGCGCUGUCAGCGGUCG | 33 | RNA cleavage |
| 10-31 | CACAGUUGUGUGAGGCGCGUGUACAGUGCGGCGGGUCU | 38 | RNA cleavage |
| 10-34 | CACAGUUGUGUGAUGGCUGGCUCUGCAGCCCGCUGGGU | 38 | RNA cleavage |
| 10-40 | CACACGUGUGUGAGGCAUGCGCUCACUGCCGUGGGUCU | 38 | RNA cleavage |
| 10-41 | CACAGUGUGUGAGGUUCGCCUCUGCCUCCCUGCUACA | 37 | RNA cleavage |
| 10-42 | CAUAGUGCGUGAGGCACGGUUACCGCCGUGGUGUGU | 36 | RNA cleavage |
| 10-49 | CACAGUGUGUGAGGCGUGCGCGAGUGGUUAGUGUCCUG | 38 | RNA cleavage |