Published on 2005 in Nucleic Acids Res. volume 33 issue 11.

PubMed ID: 15967808

DOI:10.1093/nar/gki656

Abstract:

RNA molecules with internal 2′,5′-branches are intermediates in RNA splicing, and branched RNAs have recently been proposed as retrotransposition intermediates. A broadly applicable in vitro synthetic route to branched RNA that does not require self-splicing introns or spliceosomes would substantially improve our ability to study biochemical processes that involve branched RNA. We recently described 7S11, a deoxyribozyme that was identified by in vitro selection and has general RNA branch-forming ability. However, an important restriction for 7S11 is that the branch-site RNA nucleotide must be a purine (A or G), because a pyrimidine (U or C) is not tolerated. Here, we describe the compact 6CE8 deoxyribozyme (selected using a 20 nt random region) that synthesizes 2′,5′-branched RNA with any nucleotide at the branch site. The Mn2+-dependent branch-forming ligation reaction is between an internal branch-site 2′-hydroxyl nucleophile on one RNA substrate with a 5′-triphosphate on another RNA substrate. The preference for the branch-site nucleotide is U > C ≅ A > G, although all four nucleotides are tolerated with useful ligation rates. Nearly all other nucleotides elsewhere in both RNA substrates allow ligation activity, except that the sequence requirement for the RNA strand with the 5′-triphosphate is 5′-pppGA, with 5′-pppGAR (R = purine) preferred. These characteristics permit 6CE8 to prepare branched RNAs of immediate practical interest, such as the proposed branched intermediate of Ty1 retrotransposition. Because this branched RNA has two strands with identical sequence that emerge from the branch site, we developed strategies to control which of the two strands bind with the deoxyribozyme during the branch-forming reaction. The ability to synthesize the proposed branched RNA of Ty1 retrotransposition will allow us to explore this important biochemical pathway in greater detail.



DNAzymes linked to this article:

Name Isolated sequence Length Reaction
6CE8 GGCACTCAGAGCGCACGGCG      20 RNA ligation
Copyright © Genesilico - All rights reserved
This website is free, open to all users and there is no login required.
If you have any advice or suggestions for corrections or improvements, please contact: Almudena Ponce Salvatierra